Gene
| Gene Model ID | habu1_s85_g00482 |
|---|---|
| Locus | habu1_scaffold85 : 2269 ... 5305 : - |
| To GenomeBrowser | habu1_scaffold85:2269..5305 |
| Genes list of scaffold | habu1_scaffold85 |
Annotation by Blast2GO
| Annotation | GO |
|---|---|
| isoform cra_a | GO:0005198 GO:0005637 GO:0005638 |
Hmmer Search for Pfam
| query | Total | ID | Target | From | To | Eval | Score | cEval | iEval | Score |
|---|---|---|---|---|---|---|---|---|---|---|
| habu1_s85_g00482.t1 | 1 | 1 | Filament | 33 | 119 | 3.5e-27 | 95.6 | 2.6e-30 | 3.9e-27 | 95.5 |
| habu1_s85_g00482.t1 | 1 | 1 | Myosin_tail_1 | 35 | 119 | 2.2e-08 | 32.3 | 1.6e-11 | 2.4e-08 | 32.2 |
Blast Hit to nr / sp
| query | Subject ID | Subject Name | evalue |
|---|---|---|---|
| habu1_s85_g00482.t1 | gi|532026394|ref|XP_005356179.1| | PREDICTED: lamin-B1 [Microtus ochrogaster] | 0.0 |
| habu1_s85_g00482.t1 | gi|26348034|dbj|BAC37665.1| | unnamed protein product [Mus musculus] | 0.0 |
| habu1_s85_g00482.t1 | gi|119569230|gb|EAW48845.1| | lamin B1, isoform CRA_a [Homo sapiens] | 0.0 |
Expression profile
| Libraries | FPKM |
|---|---|
| >Adult | |
| Venom fang forming tissue | 2.1 |
| Venom grand-1 | 0.5 |
| Pit, infrared sensing | 3.4 |
| Nose | 1.8 |
| Brain-1 | 0.7 |
| Eye | 1.0 |
| fetal fibroblast | 20.7 |
| venom gland-2 | 1.5 |
| Brain-2 | 0.7 |
| Spleen | 1.8 |
| Lung | 1.1 |
| Liver | 0.1 |
| Kidney | 1.1 |
| Pancreas | 0.1 |
| Small intestine | 1.6 |
| Large intestine | 0.8 |
| Stomach | 0.8 |
| heart | 0.4 |
| ovary | 12.1 |
| cheek muscle | 1.1 |
Transcript
| Transcript ID | habu1_s85_g00482.t1 |
|---|---|
| Definition | - |
>habu1_s85_g00482.t1 gttctttatcttcatcccgtttccccgcgctttgttcgcgccatggcggctgctgtggcggcttccacaccgatagggca acgcacccggagcagtgcggccagcactccgcttagtccggcccgcatcacccgcctgcaagagaaggaggaactgcggg agctcaatgaccgactggccgtttacatcgacaaggtccgcagcttggagatcgagaacagcgcgctccacctccaagtc accgagcgggaagaggtgcgcggccgtgagctcacgggccttaaatccctctatgagaccgagctggccgatgccaggcg ctctttggacgacacggctcgggagagagccaagctgcagatcgagctgggcaagatccgcgctgaacacgatcagctcc ttggcaagtaagtggctgactttgggcctgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnngacggttcaaccagaaccatgtggttttctttcgccccttagagacgctcttctattag ttgctccctaatgtaaccacgtgatcgcccatcaagggtttttttttcaggttgtccactttccacttctttctattaaa tatgttatttctccataataaaatgtttatatcatgaaaattag |
|
Protein
| Protein ID | habu1_s85_g00482.t1 |
|---|---|
| Definition | - |
>habu1_s85_g00482.t1 MAAAVAASTPIGQRTRSSAASTPLSPARITRLQEKEELRELNDRLAVYIDKVRSLEIENSALHLQVTEREEVRGRELTGL KSLYETELADARRSLDDTARERAKLQIELGKIRAEHDQLLGK |
|