Gene
Gene Model ID | pfu_aug1.0_32992.1_19482 |
---|---|
Locus | scaffold32992.1 : 5458 ... 6862 : - |
To GenomeBrowser | scaffold32992.1:5458..6862 |
Genes list of scaffold | scaffold32992.1 |
Synonym | pfu_aug2.0_2905.1_18967 |
Manual annotation
Study field | Biomineralization |
---|---|
Gene name | Pfu-prism uncharacterized shell protein 18 like |
Description | NCBI blastx best hit to CCE46170.1. |
mRNA evidence |
Expression profile
(Color code: FPKM>10&<50, blue; FPKM>50, pink)Libraries | EST count |
---|---|
>Embryonic/Larval stages | |
mix | 5 |
>Adult tissues | |
mantle | 8 |
mantleEdge | 1 |
mantlePallium | 1 |
pearlSac | 1 |
Transcript
Transcript ID | pfu_aug1.0_32992.1_19482.t1 |
---|---|
Definition | - |
>pfu_aug1.0_32992.1_19482.t1 tactgtccttggcctaaaaaatgtgtgtatggcgtatgcaaaaggggatatgcttactagatttcctcattacagttga |
Protein
Protein ID | pfu_aug1.0_32992.1_19482.t1 |
---|---|
Definition | - |
>pfu_aug1.0_32992.1_19482.t1 TVLGLKNVCMAYAKGDMLTRFPHYS |