Gene
Gene Model ID | pfu_aug1.0_6715.1_60089 |
---|---|
Locus | scaffold6715.1 : 32476 ... 34538 : + |
To GenomeBrowser | scaffold6715.1:32476..34538 |
Genes list of scaffold | scaffold6715.1 |
Synonym | NA |
Manual annotation
Study field | Transcription Factors |
---|---|
Gene name | Pfu-Oligo-related |
Description | Best hit to NP_005797 oligodendrocyte transcription factor 2 [Homo sapiens] with 3e-12 by a BLASTP search against NCBI Homo sapiens nr database. The HLH domain of this protein is partial and therefore was not included to analyses. |
mRNA evidence |
Hmmer Search for Pfam
query | Total | ID | Target | From | To | Eval | Score | cEval | iEval | Score |
---|---|---|---|---|---|---|---|---|---|---|
pfu_aug1.0_6715.1_60089.t1 | 2 | 1 | HLH | 33 | 40 | 8.0e-06 | 25.4 | 0.14 | 1000.0 | -0.5 |
pfu_aug1.0_6715.1_60089.t1 | 2 | 2 | HLH | 55 | 83 | 8.0e-06 | 25.4 | 1.1e-09 | 8.0e-06 | 25.4 |
Transcript
Transcript ID | pfu_aug1.0_6715.1_60089.t1 |
---|---|
Definition | - |
>pfu_aug1.0_6715.1_60089.t1 atgtcaagtttttgtgatgcctcaacaacagaagaaaactgcaactcaaatgaggattccattgactgcatgatgcatga tgcaaaaactgcatcgaggacaagaaaacggagatgcaatggttctctggatggattaaactcggatgaaattgttgaaa tacggtccaaaatcaacagtcgagaaagaaaaaggatgcacgatcttaatgtggcgctggataatctgagagacgtaatg ccccanttaattcgtaaattttag |
Protein
Protein ID | pfu_aug1.0_6715.1_60089.t1 |
---|---|
Definition | - |
>pfu_aug1.0_6715.1_60089.t1 MSSFCDASTTEENCNSNEDSIDCMMHDAKTASRTRKRRCNGSLDGLNSDEIVEIRSKINSRERKRMHDLNVALDNLRDVM PXLIRKF |