Gene
Gene Model ID | pfu_aug1.0_85545.1_20633 |
---|---|
Locus | scaffold85545.1 : 1 ... 2282 : - |
To GenomeBrowser | scaffold85545.1:1..2282 |
Genes list of scaffold | scaffold85545.1 |
Synonym | pfu_aug2.0_298.1_27190 |
Manual annotation
Hmmer Search for Pfam
query | Total | ID | Target | From | To | Eval | Score | cEval | iEval | Score |
---|---|---|---|---|---|---|---|---|---|---|
pfu_aug1.0_85545.1_20633.t1 | 1 | 1 | Cpn60_TCP1 | 2 | 73 | 2.6e-24 | 85.6 | 1.8e-28 | 2.7e-24 | 85.6 |
Blast Hit to nr / sp
query | Subject ID | Subject Name | evalue |
---|---|---|---|
pfu_aug1.0_85545.1_20633.t1 | gi|327268656|ref|XP_003219112.1| | PREDICTED: T-complex protein 1 subunit theta isoform X2 [Anolis carolinensis] | 2.0e-30 |
Expression profile
(Color code: FPKM>10&<50, blue; FPKM>50, pink)Libraries | EST count |
---|---|
>Embryonic/Larval stages | |
mix | 1 |
trochophore | 1 |
>Adult tissues | |
Dshape | 1 |
maleGonad | 1 |
Transcript
Transcript ID | pfu_aug1.0_85545.1_20633.t1 |
---|---|
Definition | - |
>pfu_aug1.0_85545.1_20633.t1 gtcagaacaaaatggtcatcaatcacttagaaaagctgtttgtaaccaatgacgcagctacaatattgagagaattagat gtccagcatccagcagcaaaaatggttgtcatggcgtcacatcaacaggaacaggaagttggggacggcacaaactttgt cctggtctttgccggtgctttactggaacatgcagagatgctccttcgtatggtaggtatattattattacgtgtatcat aa |
Protein
Protein ID | pfu_aug1.0_85545.1_20633.t1 |
---|---|
Definition | - |
>pfu_aug1.0_85545.1_20633.t1 QNKMVINHLEKLFVTNDAATILRELDVQHPAAKMVVMASHQQEQEVGDGTNFVLVFAGALLEHAEMLLRMVGILLLRVS |