Gene
| Gene Model ID | pfu_aug2.0_194.1_13774 |
|---|---|
| Locus | scaffold194.1 : 311728 ... 318724 : - |
| To GenomeBrowser | scaffold194.1:311728..318724 |
| Genes list of scaffold | scaffold194.1 |
| Synonym | NA |
Manual annotation
Annotation by Blast2GO
| Annotation | GO |
|---|---|
| 40s ribosomal protein s28 | GO:0003735 GO:0006407 GO:0006412 GO:0016787 GO:0022627 |
Hmmer Search for Pfam
| query | Total | ID | Target | From | To | Eval | Score | cEval | iEval | Score |
|---|---|---|---|---|---|---|---|---|---|---|
| pfu_aug2.0_194.1_13774.t1 | 1 | 1 | Ribosomal_S28e | 4 | 67 | 9.9e-34 | 114.9 | 7.1e-38 | 1.0e-33 | 114.8 |
Blast Hit to nr / sp
| query | Subject ID | Subject Name | evalue |
|---|---|---|---|
| pfu_aug2.0_194.1_13774.t1 | gi|524899093|ref|XP_005105987.1| | PREDICTED: 40S ribosomal protein S28-like [Aplysia californica] | 1.0e-35 |
| pfu_aug2.0_194.1_13774.t1 | gi|617466408|ref|XP_007573855.1| | PREDICTED: 40S ribosomal protein S28 [Poecilia formosa] | 2.0e-35 |
| pfu_aug2.0_194.1_13774.t1 | gi|62858613|ref|NP_001016950.1| | 40S ribosomal protein S28 [Xenopus (Silurana) tropicalis] | 3.0e-35 |
| pfu_aug2.0_194.1_13774.t1 | gi|57526731|ref|NP_998199.1| | 40S ribosomal protein S28 [Danio rerio] | 3.0e-35 |
| pfu_aug2.0_194.1_13774.t1 | gi|676479651|ref|XP_009061809.1| | hypothetical protein LOTGIDRAFT_150772, partial [Lottia gigantea] | 7.0e-35 |
Transcript
| Transcript ID | pfu_aug2.0_194.1_13774.t1 |
|---|---|
| Definition | - |
>pfu_aug2.0_194.1_13774.t1 atgtcagcattgcagccgattaaactagcaaaagtgctgaaggtcttaggccgtactggctctcaaggacaatgtacaca ggtccgagtagaatttcttgatgacagcaatagatccatcataaggaatgttaaaggaccggttcgtgagggagatatcc tgacactcttagaatctgaaagagaggccaggagattacggtag |
|
Protein
| Protein ID | pfu_aug2.0_194.1_13774.t1 |
|---|---|
| Definition | - |
>pfu_aug2.0_194.1_13774.t1 MSALQPIKLAKVLKVLGRTGSQGQCTQVRVEFLDDSNRSIIRNVKGPVREGDILTLLESEREARRLR |
|