Gene
| Gene Model ID | pfu_aug2.0_20404.1_16620 |
|---|---|
| Locus | scaffold20404.1 : 1 ... 1315 : + |
| To GenomeBrowser | scaffold20404.1:1..1315 |
| Genes list of scaffold | scaffold20404.1 |
| Synonym | pfu_aug1.0_50581.1_20085 |
Manual annotation
Annotation by Blast2GO
| Annotation | GO |
|---|---|
| pantothenate kinase 4-like | GO:0004594 GO:0005524 GO:0015937 GO:0016310 |
Hmmer Search for Pfam
| query | Total | ID | Target | From | To | Eval | Score | cEval | iEval | Score |
|---|---|---|---|---|---|---|---|---|---|---|
| pfu_aug2.0_20404.1_16620.t1 | 1 | 1 | Fumble | 1 | 61 | 1.1e-17 | 63.9 | 7.7e-22 | 1.1e-17 | 63.8 |
Blast Hit to nr / sp
| query | Subject ID | Subject Name | evalue |
|---|---|---|---|
| pfu_aug2.0_20404.1_16620.t1 | gi|676453181|ref|XP_009053272.1| | hypothetical protein LOTGIDRAFT_116077 [Lottia gigantea] | 1.0e-26 |
| pfu_aug2.0_20404.1_16620.t1 | gi|524892515|ref|XP_005102785.1| | PREDICTED: pantothenate kinase 4-like [Aplysia californica] | 2.0e-26 |
| pfu_aug2.0_20404.1_16620.t1 | gi|662199153|ref|XP_008472729.1| | PREDICTED: pantothenate kinase 4 [Diaphorina citri] | 3.0e-26 |
| pfu_aug2.0_20404.1_16620.t1 | gi|241304597|ref|XP_002407616.1| | pantothenate kinase, putative [Ixodes scapularis] | 9.0e-26 |
| pfu_aug2.0_20404.1_16620.t1 | gi|328703062|ref|XP_001952497.2| | PREDICTED: pantothenate kinase 4 [Acyrthosiphon pisum] | 8.0e-25 |
Transcript
| Transcript ID | pfu_aug2.0_20404.1_16620.t1 |
|---|---|
| Definition | - |
>pfu_aug2.0_20404.1_16620.t1 agtggagagggaggatgaaatgatctgtctcatagaaggttgtaatttcttgctcaaaaacattgctgacgaagcctttg tttaccagcggcatggccagccggaatataaattccagggagtagatccgaacatatttccatatttactggtcagtatt ggatctggtgttagtctagtcaag |
|
Protein
| Protein ID | pfu_aug2.0_20404.1_16620.t1 |
|---|---|
| Definition | - |
>pfu_aug2.0_20404.1_16620.t1 VEREDEMICLIEGCNFLLKNIADEAFVYQRHGQPEYKFQGVDPNIFPYLLVSIGSGVSLVK |
|