Gene
| Gene Model ID | pfu_aug2.0_3910.1_02519 |
|---|---|
| Locus | scaffold3910.1 : 49326 ... 51206 : + |
| To GenomeBrowser | scaffold3910.1:49326..51206 |
| Genes list of scaffold | scaffold3910.1 |
| Synonym | NA |
Manual annotation
Annotation by Blast2GO
| Annotation | GO |
|---|---|
| dimethylaniline monooxygenase | GO:0004499 GO:0005789 GO:0044237 GO:0044763 GO:0050660 GO:0050661 GO:0055114 |
Hmmer Search for Pfam
| query | Total | ID | Target | From | To | Eval | Score | cEval | iEval | Score |
|---|---|---|---|---|---|---|---|---|---|---|
| pfu_aug2.0_3910.1_02519.t1 | 1 | 1 | FMO-like | 9 | 85 | 3.0e-24 | 85.1 | 2.4e-28 | 3.6e-24 | 84.8 |
Blast Hit to nr / sp
| query | Subject ID | Subject Name | evalue |
|---|---|---|---|
| pfu_aug2.0_3910.1_02519.t1 | gi|676453274|ref|XP_009053302.1| | hypothetical protein LOTGIDRAFT_214741 [Lottia gigantea] | 2.0e-22 |
| pfu_aug2.0_3910.1_02519.t1 | gi|260786350|ref|XP_002588221.1| | hypothetical protein BRAFLDRAFT_57447 [Branchiostoma floridae] | 9.0e-22 |
| pfu_aug2.0_3910.1_02519.t1 | gi|260786352|ref|XP_002588222.1| | hypothetical protein BRAFLDRAFT_113828 [Branchiostoma floridae] | 2.0e-20 |
| pfu_aug2.0_3910.1_02519.t1 | gi|557317597|ref|XP_006032009.1| | PREDICTED: dimethylaniline monooxygenase [N-oxide-forming] 5-like isoform X2 [Alligator sinensis] | 6.0e-20 |
| pfu_aug2.0_3910.1_02519.t1 | gi|557317595|ref|XP_006032008.1| | PREDICTED: dimethylaniline monooxygenase [N-oxide-forming] 5-like isoform X1 [Alligator sinensis] | 8.0e-20 |
Transcript
| Transcript ID | pfu_aug2.0_3910.1_02519.t1 |
|---|---|
| Definition | - |
>pfu_aug2.0_3910.1_02519.t1 atgtcaagtgaatcggtttgcgatgctttgttgaagaaggatcccaaacttgcccttagatgtttctttggagcctgcac accctatcagtacaggttgatgggaccgaattcctgggcaggggcccgagaagccatcatgacccagtgggaccgcatat gctatccactgaaaacccgacctcttggatttgagatcgagaaatcacagctgaagttcttcctcatttactttctgttt attgcaatgtttgccttcattgtacattatctgtttatgtcgtaa |
|
Protein
| Protein ID | pfu_aug2.0_3910.1_02519.t1 |
|---|---|
| Definition | - |
>pfu_aug2.0_3910.1_02519.t1 MSSESVCDALLKKDPKLALRCFFGACTPYQYRLMGPNSWAGAREAIMTQWDRICYPLKTRPLGFEIEKSQLKFFLIYFLF IAMFAFIVHYLFMS |
|