Gene
Gene Model ID | pfu_aug1.0_3553.1_30447 |
---|---|
Locus | scaffold3553.1 : 68319 ... 71874 : - |
To GenomeBrowser | scaffold3553.1:68319..71874 |
Genes list of scaffold | scaffold3553.1 |
Synonym | NA |
Manual annotation
Expression profile
(Color code: FPKM>10&<50, blue; FPKM>50, pink)Libraries | EST count |
---|---|
>Embryonic/Larval stages | |
egg-4cell | 1 |
8-16cell | 1 |
egg-Dshape | 2 |
trochophore | 1 |
>Adult tissues | |
Dshape | 1 |
adductorMuscle | 1 |
maleGonad | 1 |
mantle | 1 |
mantlePallium | 1 |
Transcript
Transcript ID | pfu_aug1.0_3553.1_30447.t1 |
---|---|
Definition | - |
>pfu_aug1.0_3553.1_30447.t1 cccccccaacgcccgctgctttttcgctttggcccttacttccgttccatcccgcattaatcaaccttaa |
Protein
Protein ID | pfu_aug1.0_3553.1_30447.t1 |
---|---|
Definition | - |
>pfu_aug1.0_3553.1_30447.t1 PPNARCFFALALTSVPSRINQP |